Ethanol Sensitivity of GABAergic Currents in Cerebellar Granule Neurons Is Not Increased by a Single Amino Acid Change (R100Q) in the 6 GABAA Receptor Subunit

Cerebellar granule neurons (CGNs) extrasynaptically express GABAA receptors containing 6 x subunits, which mediate tonic inhibitory currents. Although it has been shown that the function of these receptors is potently and directly enhanced by ethanol, this finding has not been reproducible across different laboratories. In outbred Sprague-Dawley rats, a naturally occurring arginine (R) to glutamine (Q) mutation in position 100 of the 6 subunit was reported to increase the ethanol sensitivity of these receptors. However, we did not detect an action of this mutation in selectively bred rats (alcohol-tolerant and alcoholnontolerant). Consequently, we reexamined the effect of the mutation on ethanol sensitivity in Sprague-Dawley rats. Using patch-clamp electrophysiological techniques in cerebellar vermis parasagittal slices, we found that 25 mM ethanol increases the tonic current amplitude, tonic current noise, and spontaneous inhibitory postsynaptic current (sIPSC) frequency to a similar extent in 6-100R/100R and 6-100Q/100Q CGNs. Exposure to 80 mM ethanol increased the tonic current amplitude to a significantly greater extent in 6-100R/100R than in 6-100Q/ 100Q CGNs; however, the effects of 80 mM ethanol on the tonic current noise and sIPSC frequency were not significantly different between these groups. In the presence of tetrodotoxin, a non-N-methyl-D-aspartate receptor antagonist, exogenous GABA, and a GABA transporter inhibitor, neither 8 nor 40 mM ethanol consistently affected tonic current amplitude or noise in 6-100R/100R or 6-100Q/100Q CGNs. Thus, the 6R100Q GABAA receptor subunit polymorphism does not increase the acute ethanol sensitivity of extrasynaptic receptors, lending further support to the hypothesis that ethanol modulates these currents indirectly via a presynaptic mechanism. Studies indicate that ethanol enhances GABAergic transmission in several brain regions via presynaptic and postsynaptic mechanisms (reviewed in Siggins et al., 2005; Breese et al., 2006; Weiner and Valenzuela, 2006). Recently, ethanol has also been shown to enhance the function of subunitcontaining extrasynaptic GABAA receptors (GABAA-Rs). Sundstrom-Poromaa et al. (2002) reported that 1 to 3 mM ethanol increases currents mediated by recombinant 4 2 GABAA-Rs in Xenopus oocytes and native 4 x GABAA-Rs in acutely dissociated CA1 hippocampal neurons from a rat model of premenstrual syndrome. Subsequently, ethanol was shown to potentiate Xenopus oocyte-expressed 4 3 and 6 3 recombinant receptors at concentrations 3 mM and the imidazobenzodiazepine Ro 15-4513 competitively blocked this effect (Wallner et al., 2003, 2006; Hanchar et al., 2006; Olsen et al., 2007). Tonic currents mediated by 4 x GABAA-Rs in dentate gyrus granule cells and ventrobasal thalamic neurons were shown to be significantly potentiated by ethanol ( 30 mM) in a protein kinase C -dependent manner (Wei et al., 2004; Liang et al., 2006; Fleming et al., 2007; Jia et al., 2007; Messing et al., 2007; Mody et al., 2007). Glykys et al. (2007) reported that ethanol ( 20 mM) enhances 1 x GABAA-R-dependent currents in hippocampal This work was supported by National Institutes of Health Grant AA14973. P.B. and M.M. contributed equally to this work. 1 Current affiliation: Department of Basic Neurosciences, University of Geneva, Geneva, Switzerland. Article, publication date, and citation information can be found at http://jpet.aspetjournals.org. doi:10.1124/jpet.107.127894. ABBREVIATIONS: GABAA-R, type-A -aminobutyric acid receptor; CGN, cerebellar granule neuron; Ro 15–4513, ethyl 8-azido-6-dihydro-5methyl-6-oxo-4H-imidazo[1,5]-[1,4]benzodiazepine-3-carboxylate; IPSC, inhibitory postsynaptic current; sIPSC, spontaneous IPSC; TTX, tetrodotoxin; AT, alcohol-tolerant; ANT, alcohol-nontolerant; ACSF, artificial cerebrospinal fluid; NO-711, 1-(2-(((diphenylmethylene)amino)oxy) ethyl)-1,2,5,6-tetrahydro-3-pyridinecarboxylic acid; ANOVA, analysis of variance. 0022-3565/07/3232-684–691$20.00 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS Vol. 323, No. 2 Copyright © 2007 by The American Society for Pharmacology and Experimental Therapeutics 127894/3268402 JPET 323:684–691, 2007 Printed in U.S.A. 684 at A PE T Jornals on July 0, 2017 jpet.asjournals.org D ow nladed from molecular layer interneurons. Hanchar et al. (2005) demonstrated that a single amino acid change (R100Q) in the 6 subunit enhances the potentiating effect of ethanol on currents mediated by recombinant 6 3 but not 6 2 receptors. Extrasynaptic receptors containing 6 x subunits are selectively expressed in cerebellar granule neurons (CGNs). Hanchar et al. (2005) found that 10 mM ethanol directly potentiates these receptors in slices from Sprague-Dawley rats homozygous for 6-100Q, which also display higher sensitivity to ethanol-induced motor impairment. Although these results suggest that extrasynaptic GABAA-Rs are targets of ethanol, the findings of several studies are inconsistent with this notion. Mehta et al. (2007) and Korpi et al. (2007) did not detect effects of ethanol on [H]Ro 15-4513 binding to subunit-containing GABAA-Rs. Borghese et al. (2006) found that 4 3 GABAA-Rs expressed in either Xenopus oocytes or fibroblasts are minimally affected by subanesthetic concentrations of ethanol and that 30 mM ethanol does not affect tonic GABAergic currents in dentate gyrus granule cells (reviewed in Borghese and Harris, 2007). Lack of a direct effect of acute ethanol (50–100 mM) exposure on tonic GABAergic currents in dentate gyrus granule cells was also recently reported by another group (Talani et al., 2007). Yamashita et al. (2006) found that ethanol (10, 30, and 100 mM) had either no effect or an inhibitory effect on currents mediated by 4 3 , 6 2 , or 6 3 GABAA-R subunits expressed in Chinese hamster ovary cells. Similarly, an inconsistent effect of ethanol (30 mM) on steady-state currents induced by continuous application of low GABA concentrations was observed in cultured CGNs. Casagrande et al. (2007) did not detect a significant effect of 10 and 30 mM ethanol on currents evoked by low GABA concentrations in cultured CGNs. Carta et al. (2004) found that ethanol ( 20 mM) (see Carta et al. for ethanol dose-response data) increases both the frequency of spontaneous inhibitory postsynaptic currents (sIPSCs) and tonic current noise and that this effect was not observed when spontaneous action potentials were blocked with tetrodotoxin (TTX). Ethanol also increased the frequency of spontaneous action potentials in Golgi cells, suggesting that it enhances phasic and tonic GABAergic transmission onto CGNs via an indirect presynaptic mechanism (Carta et al., 2004). Studies carried out with alcohol-tolerant (AT) (homozygous for 6-100R) and alcohol-nontolerant (ANT) (homozygous for 6-100Q) rats suggest that the 6 GABAA-R subunit polymorphism does not contribute to ethanol-induced ataxia (Radcliffe et al., 2004; Botta et al., 2007; Korpi et al., 2007). Electrophysiological experiments with AT and ANT rats indicate that the 6 GABAA-R subunit polymorphism does not modulate ethanol sensitivity of phasic or tonic GABAergic currents in CGNs (Valenzuela et al., 2005; Botta et al., 2007). We conclude that, although several independent studies have shown that tonic GABAergic currents are modulated by ethanol, it is still uncertain if this is a consequence of direct potentiation of subunit-containing extrasynaptic GABAA-Rs (Lovinger and Homanics, 2007). The purpose of this study was to reexamine the influence of the 6-R100Q subunit polymorphism on ethanol sensitivity of these receptors in CGNs. We hypothesized that confounding genetic factors present in AT and ANT rats and/or our choice of experimental conditions prevented us from detecting an effect of this polymorphism (Otis et al., 2005; Valenzuela et al., 2005). We tested this hypothesis using similar ethanol concentrations and experimental conditions to those used by Hanchar et al. (2005). Materials and Methods Genotyping. Male Sprague-Dawley rats (22–23 days old) were obtained from Charles River Laboratories (area H-41; Hollister CA). The rats were housed at the University of New Mexico Health Sciences Center Animal Resource Facility. All animal procedures were approved by the University of New Mexico Health Sciences Center Institutional Animal Care and Use Committee. Ear punch samples (1–2 mm in diameter) were obtained and shipped frozen to the University of Colorado Health Sciences Center for 6 subunit single nucleotide polymorphism genotyping, which was accomplished using the Amplification Refractory Mutation System method as detailed in Saba et al. (2001). Briefly, ear punch samples were incubated in digestion buffer (10 mM NaOH and 0.1 mM EDTA) at 95°C for 10 min. DNA was quantified by spectrophotometry and diluted with H2O accordingly. Two PCR amplifications were performed on each sample using standard reagents and cycling conditions (12 min at 95°C; 30 cycles: 30 s at 94°C, 30 s at 55°C, 60 s at 72°C; and 7 min at 72°C). One reaction contained a forward primer that was complementary to the sequence of the 3 to 5 DNA strand for 6-100R (TAAGATCTGGACTCCGGACACATTTTTGCG) and the second reaction contained a forward primer complementary to the sequence of the 3 to 5 DNA strand for 6-100Q (TAAGATCTGGACTCCGGACACATTTTTGCA); the 6 single nucleotide polymorphism is at the last position of the primer (note that the last base of the R (CGA) and Q codons (CAA) is not part of the forward primer sequence). A common reverse primer was included in each reaction to yield a product of 118 base pairs (CATGGTGTACAGGATCGTTC). Both reactions also contained a control primer pair to verify that the amplification was successful (forward: TTCTCCCCTGGCTCTTCAG; reverse: AGTTCCCTTCATCTTCAAGTTGAG; product 268 base pairs). The method relies on the tolerance of Taq polymerase for a single mismatch placed at the third position from the 3 end of the forward primer sequence (C has been replaced with G), but not two mismatches as would be the case, for example, when the 100R primer hybridizes to 100Q template. Thus, amplification takes place only in the presence of a matching combination of forward primer and template. PCR products were analyzed with a Bioanalyzer 2100 (Agilent Technologies, Santa Clara, CA), which uses a microfluidics based method of electrophoresis. An example of a virtual gel image is shown in Fig. 1, where subjects 15, 6, and 7 are heterozygous (100R/ 100Q), subject 16 is homozygous for glutamine (100Q/100Q), and subject 8 is homozygous for arginine (100R/100R). Genotyping was performed in a total of 56 rats, and these were found to follow an expected 25:50:25 Mendelian distribution ( , p 0.8): G/G (100R/ 100R; n 14), 25%; G/A (100R/100Q; n 30), 54%; and A/A (100Q/ 100Q; n 12), 21%, in agreement with the report of Hanchar et al. (2005). Electrophysiology. Unless indicated, all chemicals were from Sigma-RBI-Fluka (St. Louis, MO). Experiments were performed in parasagittal vermis cerebellar slices that were prepared from the genotyped rats (homozygous only) when they were 27 to 38 days old. Animals were euthanized by rapid decapitation under deep anesthesia with ketamine (250 mg/kg i.p.) and 200to 250m-thick slices were prepared with a Vibratome. Slices were cut in cold solution containing 220 mM sucrose, 26 mM NaHCO3, 10 mM glucose, 6 mM MgSO4, 3 mM KCl, 1.25 mM NaH2PO4, 0.2 mM CaCl2, and 0.43 mM ketamine. This solution was preequilibrated with 95% O2 plus 5% CO2. Immediately after the slicing procedure, slices were transferred to a chamber containing artificial cerebrospinal fluid (ACSF) and allowed to recover at 36°C for 45 min, followed by storage at room temperature in the same ACSF (Aitken et al., 1995). ACSF contained 126 mM NaCl, 3 mM KCl, 1.25 mM NaH2PO4, 1 mM MgSO4, 26 mM NaHCO3, 2 mM CaCl2, and 10 mM glucose equilibrated with 95% O2 plus 5% CO2. After a total recovery time 80 min, slices were 6 GABAA Receptor Subunit and Ethanol Sensitivity 685 at A PE T Jornals on July 0, 2017 jpet.asjournals.org D ow nladed from transferred to a chamber perfused with ACSF at a rate of 2 to 3 ml/min. Whole-cell patch-clamp electrophysiological recordings from CGNs were performed under infrared-differential interference contrast microscopy with Axopatch 200B or Multiclamp 700B amplifiers (Molecular Devices, Sunnyvale, CA). Patch pipettes had resistances of 4 to 6 M . Similarly to the conditions of Hanchar et al. (2005), recordings were obtained in ACSF at 23°C with an internal solution containing 140 mM CsCl, 10 mM HEPES (pH 7.3), 1 mM EGTA, 4 mM magnesium ATP, 0.4 mM GTP, and 4 mM QX-314 (TocrisCookson, Ellisville, MO) at a holding membrane potential of 70 mV. When indicated, TTX, bicuculline methiodide, GABA, NO-711, 2,3-dihydroxy-6-nitro-7-sulfamoyl-benzo[f]quinoxaline-2,3-dione (NBQX) (Axxora Life Sciences, Inc., San Diego, CA), and ethanol (190 proof, spectrophotometric grade, Sigma Chemical, St. Louis, MO) were added to the ACSF. CGNs were identified on the basis of their location in the granule layer and their small size (capacitance 5 pF). Access resistance was between 20 and 40 M , and we did not compensate for this; if access resistance changed more than 25%, the recording was discarded. Data Analysis. Data were acquired and analyzed with pClamp 8 or 9 (Molecular Devices, Sunnyvale, CA); sIPSCs were analyzed with the Mini Analysis program (Synaptosoft, Decatur, GA). The tonic current was calculated by fitting a Gaussian distribution to all-point histograms, constraining the values to 2 bins more negative than the peak to limit the influence of sIPSCs on the fit (Hanchar et al., 2005). Tonic current amplitude was defined as the mean steady-state current recorded in the absence minus that recorded in the presence of 20 M of the GABAA-R antagonist bicuculline. The tonic current noise was defined as the S.D. of the steady-state current recorded in the absence minus that recorded in the presence of bicuculline. The effect of ethanol was calculated with respect to the average of control and washout responses. The Kolmogorov-Smirnov test was used initially to test for significant differences between treatments on sIPSCs in individual cells. Pooled data were statistically analyzed with Prism 4 (GraphPad Software, Inc., San Diego, CA). Data are presented as means S.E.M.